Catálogo de Informação Agropecuária

Consulta

 






Registro Completo
Biblioteca(s):  Epagri-Sede.
Data corrente:  13/12/2023
Data da última atualização:  13/12/2023
Tipo da produção científica:  Resumo em Anais de Congresso
Autoria:  SCHEUERMANN, K. K.; PEREIRA, A.; KLOCK, A. L. S.; VISCONTI, A.
Título:  Desenvolvimento de uma base de dados de genes de resistência à brusone do arroz.
Ano de publicação:  2023
Fonte/Imprenta:  In: CONGRESSO BRASILEIRO DE FITOPATOLOGIA, 53., 2023, Brasília. Resumos... Brasília: Sociedade Brasileira de Fitopatologia, 2023. p. 122
Idioma:  Português
Conteúdo:  A resistência genética é a estratégia mais eficiente e econômica para controle da brusone do arroz, causada pelo fungo Pyricularia oryzae. Atualmente são conhecidos 146 genes de resistência, sendo 37 deles molecularmente caracterizados. A partir deste conhecimento, marcadores moleculares têm sido desenvolvidos, tornando possível a identificação de germoplasmas portadores destes genes, e seu emprego em programas de melhoramento visando à obtenção de resistência durável à brusone. O objetivo deste trabalho foi prospectar o banco de germoplasma de arroz da Epagri, utilizando marcadores moleculares para os genes de resistência à brusone Pi54, Pikm1, Pi2, Pi40, e Pita2. Para isso, foram empregados os marcadores Pi54MAS (F: caatctccaaagttttcagg; R: gcttcaatcactgctagacc), CKm1 (F: tgagctcaaggcaagagttgagga; R: tgttccagcaactcgatgag), CAPS-2LRR (F: cgttgtataggacagtttcatt; R: aatctaggcactcaagtgttc) digerido com a enzima PstI, CAPS-9871.T7E2b (F: caacaaacgggtcgacaaagg; R: cccccaggtcgtgataccttc), digerido com a enzima Tsp509I e Z12 (F: tgcagatttgactgctcggt; R: gggatcttcctcgcccaaa) respectivamente. Os amplicons produzidos foram resolvidos em gel de agarose, exceto para o gene Pita2, em que o oligonucleotídeo F recebeu uma calda M13 (tgtaaaacgacggccagt) tornando possíveis as análises em analisador genético. Foram avaliados 517 acessos incluindo as principais cultivares de arroz já empregadas ou em uso no Brasil. As análises para a presença do gene Pi54 revelaram que 42,2% dos materiais av... Mostrar Tudo
Thesagro:  Magnaporthe oryzae; piramidização gênica; resistência genética.
Categoria do assunto:  G Melhoramento Genético
 
Marc:  Mostrar Marc Completo
Registro original:  Epagri-Sede (Epagri-Sede)
Biblioteca ID Origem Tipo/Formato Classificação Cutter Registro Volume Status  
Epagri-Sede109032 - 1UPCPL - DD
Voltar






Ordenar por: RelevânciaAutorTítuloAnoImprime registros no formato resumido      Imprime registros no formato resumido
Registros recuperados : 24
Primeira ... 12 ... Última
1.Imagem marcado/desmarcadoBRUGNARA, E. C.; KLOCK, A. L. S.; SABIÃO, R. R. Concentração de prolina em folhas de oliveira (Olea europaea L.) aspergidas com L-prolina e fertilizante foliar. In: SIMPOSIO DE FRUTICULTURA DA REGIÃO SUL, 3., 2022, Online. Resumos... Chapecó: Epagri, 2022.
Tipo: Resumo em Anais de Congresso
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
2.Imagem marcado/desmarcadoKLOCK, A. L. S.; FACHINELLO, M.; VERONA, L. A. F. Qualidade da água em agroecossistemas de base familiar com produção orgânica de hortaliças. Cadernos de Agroecologia, Cruz Alta, RS, Brasil , v. 8, n. 2, p. 1-5, 2013.
Tipo: Artigo em Periódico IndexadoCirculação/Nível: Nacional - B
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
3.Imagem marcado/desmarcadoDORIGON, C.; NESI, C. N.; KLOCK, A. L. S. Qualidade da água em propriedades produtoras de queijo colonial para o autoconsumo - o caso de São Miguel do Oeste. In: WORKSHOP DE CIÊNCIA E INOVAÇÃO EM PECUÁRIA, 1., 2020, Lages. Anais... Florianópolis: Epagri, 2020. p. 114-115.
Tipo: Resumo em Anais de Congresso
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
4.Imagem marcado/desmarcadoWILDNER, L. P.; KLOCK, A. L. S.; SPAGNOLLO, E. Educação ambiental no Centro de Pesquisas para a Agricultura Familiar (Epagri/Cepaf), Chapecó, SC. In: WORKSHOP DE PRÁTICAS EM EDUCAÇÃO AMBIENTAL, 1., 2013, Chapecó, SC. Anais... Chapecó, SC: UNOESC, 2013.
Tipo: Artigo em Anais de Congresso / Nota Técnica
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
5.Imagem marcado/desmarcadoBRUGNARA, E. C.; KLOCK, A. L. S.; WORDELL FILHO, J. A. Aspersões de silicato de potássio não afetam o conteúdo de silício das folhas de oliveira (Olea europaea L.). In: SIMPÓSIO DE FRUTICULTURA DA REGIÃO SUL, 3., 2022, Online. Resumos... Chapecó: Epagri, 2022.
Tipo: Resumo em Anais de Congresso
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
6.Imagem marcado/desmarcadoSCHVEITZER, B.; KLOCK, A. L. S.; ROSA, A. M.; RIZZATTI, I. Avaliação dos teores minerais em mas das cultivares Fuji e Gala durante as safras de 2008 a 2010. In: REUNIÃO ANUAL DA SOCIEDADE BRASILEIRA DE QUÍMICA , 34., 2011, Florianópolis, SC. [Anais...]. São Paulo: Sociedade Brasileira de Qumica (online), 2011.
Tipo: Resumo em Anais de CongressoCirculação/Nível: -- - --
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
7.Imagem marcado/desmarcadoCARASEK, F. L.; MAGRO, J. D.; KLOCK, A. L. S.; SCHEIBE, L. F. CLASSIFICAÇÃO HIDROQUÍMICA DO SISTEMA AQUÍFERO SERRA GERAL (SASG) EM UMA ÁREA INSERIDA NA BACIA DO RIO CHAPECÓ/IRANI-MUNICÍPIO DE CHAPECÓ-SC. In: ENCONTRO SOBRE MEIO AMBIENTE E DESENVOLVIMENTO NA GRANDE FRONTEIRA MERCOSUL, 1., 2016, Chapecó, SC. Anais... São Leopoldo, RS: Editora Karywa, 2016. p. 112-116.
Tipo: Resumo em Anais de Congresso
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
8.Imagem marcado/desmarcadoMATTHIENSEN, A.; KLOCK, A. L. S.; BEDENDO, G. C.; MARTINI, R. Monitoramento e diagóstico de qualidade de água superficial. Florianópolis, SC: Universidade Federal de Santa Catarina, 2014. 127p.
Tipo: Documentos
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
9.Imagem marcado/desmarcadoCOMASSETTO, V.; BALDISSERA, I.T.; KLOCK, A.L.S.; PESSATTO, I.; ROCHA, R. Qualidade da água de fontes superficiais modelo Caxambu em propriedades rurais do Oeste catarinense. Florianópolis, SC: Epagri, 2011. 29p. (Epagri. Boletim Técnico, 155).
Tipo: Boletim de Pesquisa e DesenvolvimentoCirculação/Nível: -- - --
Biblioteca(s): Epagri-Chapecó; Epagri-São Joaquim; Epagri-Sede; Epagri-Videira.
Visualizar detalhes do registroImprime registro no formato completo
10.Imagem marcado/desmarcadoBALDISSERA, I. T.; BAMPI, D.; KLOCK, A. L. S.; BOTTIN, J. Qualidade da água da rede hídrica do Lajeado São José utilizada para abastecimento urbano da cidade de Chapecó,SC. Agropecuária Catarinense, Florianopolis, v. 23, n. 3, p. 66-70, 2010.
Tipo: Artigo em Periódico IndexadoCirculação/Nível: -- - --
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
11.Imagem marcado/desmarcadoKLOCK, A. L. S.; GUARDA, J. S.; CELLA, J.; SILVA, M. L.; KLOCK FILHO, L. P. Qualidade das águas de poços profundos do município de águas frias, SC em relação: portaria 2914 do Ministério da Saúde. In: CONGRESSO BRASILEIRO DE ÁGUAS SUBTERRÂNEAS, 18., 2014, Belo Horizonte, MG. Anais... São Paulo, SP: ABAS, 2014. p. 1-13.
Tipo: Artigo em Anais de Congresso / Nota Técnica
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
12.Imagem marcado/desmarcadoSCHEUERMANN, K. K.; PEREIRA, A.; KLOCK, A. L. S.; VISCONTI, A. Desenvolvimento de uma base de dados de genes de resistência à brusone do arroz. In: CONGRESSO BRASILEIRO DE FITOPATOLOGIA, 53., 2023, Brasília. Resumos... Brasília: Sociedade Brasileira de Fitopatologia, 2023. p. 122
Tipo: Resumo em Anais de Congresso
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
13.Imagem marcado/desmarcadoSCHVEITZER, B.; KLOCK, A. L. S.; ROSA, A. M.; RIZZATTI, I. Determinação de macro e micronutrientes em pinhões semente de Araucária angustifolia sob diferentes formas de preparo. In: REUNIÃO ANUAL DA SOCIEDADE BRASILEIRA DE QUÍMICA, 34., 2011, Florianópolis, SC. [Anais...]. São Paulo: Sociedade Brasileira de Qumica (online), 2011.
Tipo: Resumo em Anais de CongressoCirculação/Nível: -- - --
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
14.Imagem marcado/desmarcadoSCHVEITZER, B.; ROSA, A. M.; GRANEMANN, P.; KLOCK, A. L. S.; RIZZATTI, I. M.; FOPPA, T. Caracterização química de pinhões ? sementes de araucária angustifolia ? em diferentes formas de preparo. Revista Interdisciplinar de Estudos em Saúde, Caçador, SC, v. 3, n. 1, p. 93-104, 2014.
Tipo: Artigo em Periódico IndexadoCirculação/Nível: Nacional - C
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
15.Imagem marcado/desmarcadoBALDISSERA, I. T.; STEFFENS, R. F.; KLOCK, A. L. S.; OLIVEIRA, Y. V. Cisternas: armazenamento de agua nas propriedades rurais. Florianópolis, SC: Epagri, 2011. 23p. (Epagri. Boletim Didático, 90)
Tipo: Boletim de Pesquisa e Desenvolvimento
Biblioteca(s): Epagri-Chapecó; Epagri-São Joaquim; Epagri-Sede; Epagri-Videira.
Visualizar detalhes do registroImprime registro no formato completo
16.Imagem marcado/desmarcadoBALDISSERA, I. T.; STEFFENS, R. F.; OLIVEIRA, Y. V.; KLOCK, A. L. S. Cisternas: Construção, utilização e manutenção. Florianópolis: Epagri, 2015. 32 p. (Epagri. Boletim Técnico, 167).
Tipo: Boletim de Pesquisa e Desenvolvimento
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
17.Imagem marcado/desmarcadoSOUZA, R. T. M.; MARTINS, S. R.; VERONA, L. A. F.; KLOCK, A. L. S. Indicadores de sustentabilidade em agroecossistemas familiares de produção agroecológica em Chapecó-SC uma avaliação direcionada aos recursos hídricos. Cadernos de Agroecologia , Cruz Alta, RS, Brasil, v. 8, n. 2, p. 1-5, 2013.
Tipo: Artigo em Periódico IndexadoCirculação/Nível: Nacional - B
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
18.Imagem marcado/desmarcadoCOMASSETTO, V.; BALDISSERA, I. T.; KLOCK, A. L. S.; ROCHA, R.; PESSATTO, I. T.; OLIVEIRA, Y. V. Qualidade da água de fontes superficiais modelo Caxambu em propriedades rurais do Oeste Catarinense. In: SIMPÓSIO BRASILEIRO DE RECURSOS HÍDRICOS, 19., 2011, Maceió. Programa Final... Maceió, AL: Associação Brasileira de Recursos Hídricos, 2011. p. 48.
Tipo: Resumo em Anais de CongressoCirculação/Nível: -- - --
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
19.Imagem marcado/desmarcadoCOMASSETTO, V.; BALDISSERA, I. T.; PESSATTO, I. T.; KLOCK, A. L. S.; ROCHA, R.; OLIVEIRA, Y. V. Qualidade de água de fontes superficiais modelo Caxambú em propriedades rurais do Oeste Catarinense. In: COMASSETTO, V. (Org.). Pesquisas em Recursos Hídricos na Bacia do Rio Jacutinga e Sub-Bacias Contíguas. Concórdia, SC: Gráfica Sul Oeste, 2013. p. 193-220.
Tipo: Capítulo em Livro Técnico-CientíficoCirculação/Nível: -- - --
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
20.Imagem marcado/desmarcadoSCHAFASCHEK, T. P.; KLABUNDE, G. H. F.; MANFIO, C. E.; PEREIRA, A.; KLOCK, A. L. S.; MENDES, S. D. C. Molecular identification of the hygienic behavior in colonies of Africanized bees (Apis mellifera L.). In: INTERNATIONAL APICULTURAL CONGRESS, 48., 2023, Santiago, Chile. Abstracts... Santiago, Chile: Apimondia, 2023. p. 147
Tipo: Resumo em Anais de Congresso
Biblioteca(s): Epagri-Sede.
Visualizar detalhes do registroImprime registro no formato completo
Registros recuperados : 24
Primeira ... 12 ... Última
Nenhum registro encontrado para a expressão de busca informada.
 
 

EPAGRI
Todos os direitos reservados, conforme Lei n° 9.610
Política de Privacidade

.

Valid HTML 4.01 Transitional